This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012843


Marker Name:  FCA305 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GGGTATTTACCCAAGAACATGG
Primer: TGTTCATACACATACCTGCGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130602

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B2a Cat
chromosome B2
14.000 14.000 14.000
Menotti-Raymond, M et al 2003: B2 Cat
chromosome B2
86.300 86.300 86.300
Menotti-Raymond, Marilyn et al 1999 (A): B2a Cat
chromosome B2
0.000 0.000 0.000
Murphy et al 2006: B2 Cat
chromosome B2
81.100 81.100 81.100


© The Roslin Institute 2007-2012, all rights reserved