This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012831


Marker Name:  FCA126 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GCCCCTGATACCCTGAATG
Primer: CTATCCTTGCTGGCTGAAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130532

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B1a Cat
chromosome B1
181.000 181.000 181.000
Menotti-Raymond, M et al 2003: B1 Cat
chromosome B1
1040.500 1040.500 1040.500
Menotti-Raymond, Marilyn et al 1999 (A): B1a Cat
chromosome B1
127.000 127.000 127.000
Murphy et al 2006: B1 Cat
chromosome B1
1159.400 1159.400 1159.400


© The Roslin Institute 2007-2012, all rights reserved