This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012829


Marker Name:  FCA564 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GAGGTGAGGTCCTTGCATC
Primer: GGGAACAGGTATGTTGAAATGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B1a Cat
chromosome B1
165.000 165.000 165.000
Menotti-Raymond, M et al 2003: B1 Cat
chromosome B1
921.500 921.500 921.500
Menotti-Raymond, Marilyn et al 1999 (A): B1a Cat
chromosome B1
96.000 96.000 96.000
Murphy et al 2006: B1 Cat
chromosome B1
1019.100 1019.100 1019.100


© The Roslin Institute 2007-2012, all rights reserved