This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012823


Marker Name:  FCA254 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CAGATGCTCAACCGACTAAGC
Primer: GCTTTGGCAACCCCTCTAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130586

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B1a Cat
chromosome B1
69.000 69.000 69.000
Menotti-Raymond, M et al 2003: B1 Cat
chromosome B1
679.700 679.700 679.700
Menotti-Raymond, Marilyn et al 1999 (A): B1a Cat
chromosome B1
63.000 63.000 63.000
Murphy et al 2006: B1 Cat
chromosome B1
733.100 733.100 733.100


© The Roslin Institute 2007-2012, all rights reserved