This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012821


Marker Name:  FCA339 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCTTTTTCTTGCTTTCCAAAAG
Primer: GTAAGGACACTGGTACCAAGCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130610

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B1a Cat
chromosome B1
52.000 52.000 52.000
Menotti-Raymond, M et al 2003: B1 Cat
chromosome B1
566.100 566.100 566.100
Menotti-Raymond, Marilyn et al 1999 (A): B1a Cat
chromosome B1
47.000 47.000 47.000
Murphy et al 2006: B1 Cat
chromosome B1
643.800 643.800 643.800


© The Roslin Institute 2007-2012, all rights reserved