This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012818


Marker Name:  FCA023 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CAGTTCCTTTTTCTCAAGATTGC
Primer: GCAACTCTTAATCAAGATTCCATT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130481

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B1a Cat
chromosome B1
43.000 43.000 43.000
Menotti-Raymond, M et al 2003: B1 Cat
chromosome B1
597.100 597.100 597.100
Menotti-Raymond, Marilyn et al 1999 (A): B1a Cat
chromosome B1
41.000 41.000 41.000
Murphy et al 2006: B1 Cat
chromosome B1
664.300 664.300 664.300


© The Roslin Institute 2007-2012, all rights reserved