This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012812


Marker Name:  FCA334 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGTTCACACCCAGTGGAAGA
Primer: CAAATTTCAGGCAAATGAATTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130609

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A3f Cat
chromosome A3
16.000 16.000 16.000
Menotti-Raymond, M et al 2003: A3 Cat
chromosome A3
1359.800 1359.800 1359.800
Menotti-Raymond, Marilyn et al 1999 (A): A3e Cat
chromosome A3
0.000 0.000 0.000
Murphy et al 2006: A3 Cat
chromosome A3
1429.600 1429.600 1429.600


© The Roslin Institute 2007-2012, all rights reserved