This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012803


Marker Name:  FCA536 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CACAGCACCTGGTTCTTTGA
Primer: CGCGTACTCTCTCTCTCGCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130651

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A3b Cat
chromosome A3
49.000 49.000 49.000
Menotti-Raymond, M et al 2003: A3 Cat
chromosome A3
764.900 764.900 764.900
Menotti-Raymond, Marilyn et al 1999 (A): A3a Cat
chromosome A3
31.000 31.000 31.000
Murphy et al 2006: A3 Cat
chromosome A3
954.500 954.500 954.500


© The Roslin Institute 2007-2012, all rights reserved