This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012800


Marker Name:  FCA498 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GATAGATGGGGTTTTTGGGG
Primer: TGGATTGCTATGGCCAAAAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130636

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A3b Cat
chromosome A3
27.000 27.000 27.000
Menotti-Raymond, M et al 2003: A3 Cat
chromosome A3
581.000 581.000 581.000
Menotti-Raymond, Marilyn et al 1999 (A): A3a Cat
chromosome A3
53.000 53.000 53.000
Murphy et al 2006: A3 Cat
chromosome A3
812.100 812.100 812.100


© The Roslin Institute 2007-2012, all rights reserved