This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012786


Marker Name:  FCA340 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GACTGAGCCACCCAGGTG
Primer: CCCTTTCTCCCCATTTTATC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130611

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A2b Cat
chromosome A2
28.000 28.000 28.000
Menotti-Raymond, M et al 2003: A2 Cat
chromosome A2
1143.700 1143.700 1143.700
Menotti-Raymond, Marilyn et al 1999 (A): A2d Cat
chromosome A2
51.000 51.000 51.000
Murphy et al 2006: A2 Cat
chromosome A2
1526.800 1526.800 1526.800


© The Roslin Institute 2007-2012, all rights reserved