This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012784


Marker Name:  FCA105 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TTGACCCTCATACCTTCTTTGG
Primer: TGGGAGAATAAATTTGCAAAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130523

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A2b Cat
chromosome A2
15.000 15.000 15.000
Menotti-Raymond, M et al 2003: A2 Cat
chromosome A2
1122.200 1122.200 1122.200
Menotti-Raymond, Marilyn et al 1999 (A): A2d Cat
chromosome A2
64.000 64.000 64.000
Murphy et al 2006: A2 Cat
chromosome A2
1505.300 1505.300 1505.300


© The Roslin Institute 2007-2012, all rights reserved