This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012778


Marker Name:  FCA052 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGTATCCTCTGCTCCTGAAACA
Primer: ACCTGTCCCAGTGCTTGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130493

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A2a Cat
chromosome A2
47.000 47.000 47.000
Menotti-Raymond, M et al 2003: A2 Cat
chromosome A2
237.100 237.100 237.100
Menotti-Raymond, Marilyn et al 1999 (A): A2a Cat
chromosome A2
32.000 32.000 32.000


© The Roslin Institute 2007-2012, all rights reserved