This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012776


Marker Name:  FCA581 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCTTGCTCCAACACTTGCAC
Primer: GGACCCACACACACCTGACTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130667

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A2a Cat
chromosome A2
12.000 12.000 12.000
Menotti-Raymond, M et al 2003: A2 Cat
chromosome A2
190.200 190.200 190.200
Menotti-Raymond, Marilyn et al 1999 (A): A2a Cat
chromosome A2
75.000 75.000 75.000
Murphy et al 2006: A2 Cat
chromosome A2
272.400 272.400 272.400


© The Roslin Institute 2007-2012, all rights reserved