This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012775


Marker Name:  IMPDH2 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AGTGACAGGAGCTGCCCTTA
Primer: CTTGCTGGCAAGAAAGACAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646776

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A2a Cat
chromosome A2
8.000 8.000 8.000
Menotti-Raymond, M et al 2003: A2 Cat
chromosome A2
205.900 205.900 205.900
Murphy et al 2006: A2 Cat
chromosome A2
261.700 261.700 261.700


© The Roslin Institute 2007-2012, all rights reserved