This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012773


Marker Name:  FCA678 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AGCAATCTCCAGAATGTGTGG
Primer: TCAAAAGATTAAAGCCTTCCAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130693

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A1d Cat
chromosome A1
140.000 140.000 140.000
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
1904.700 1904.700 1904.700
Menotti-Raymond, Marilyn et al 1999 (A): A1b Cat
chromosome A1
0.000 0.000 0.000
Murphy et al 2006: A1 Cat
chromosome A1
2295.700 2295.700 2295.700


© The Roslin Institute 2007-2012, all rights reserved