This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012772


Marker Name:  FCA008 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ACTGTAAATTTCTGAGCTGGCC
Primer: TGACAGACTGTTCTGGGTATGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130476

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A1d Cat
chromosome A1
119.000 119.000 119.000
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
1852.000 1852.000 1852.000
Menotti-Raymond, Marilyn et al 1999 (A): A1b Cat
chromosome A1
22.000 22.000 22.000
Murphy et al 2006: A1 Cat
chromosome A1
2245.200 2245.200 2245.200


© The Roslin Institute 2007-2012, all rights reserved