This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012749


Marker Name:  FCA024 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCCAGCTTTGTCTCTTACTGTG
Primer: CATCCTCCCCTAATGCCC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A1b Cat
chromosome A1
53.000 53.000 53.000
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
601.900 601.900 601.900
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
140.000 140.000 140.000
Murphy et al 2006: A1 Cat
chromosome A1
742.100 742.100 742.100


© The Roslin Institute 2007-2012, all rights reserved