This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012745


Marker Name:  FCA499 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGGTTTATCACAGGCTGATAGC
Primer: AGGTGCTCTGGAGGAGTTGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130637

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A1b Cat
chromosome A1
36.000 36.000 36.000
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
388.000 388.000 388.000
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
156.000 156.000 156.000
Murphy et al 2006: A1 Cat
chromosome A1
470.500 470.500 470.500


© The Roslin Institute 2007-2012, all rights reserved