This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012744


Marker Name:  F42 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCCACGTGGACTAATCAAAT
Primer: CACTGCACAAATTAAGAGGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A1b Cat
chromosome A1
32.000 32.000 32.000
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
378.700 378.700 378.700
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
160.000 160.000 160.000
Murphy et al 2006: A1 Cat
chromosome A1
461.100 461.100 461.100


© The Roslin Institute 2007-2012, all rights reserved