This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012743


Marker Name:  FCA280 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ACCTCAAACGGTATGAATACCA
Primer: GTCCCAGGAAAGATTTTGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130596

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): A1b Cat
chromosome A1
28.000 28.000 28.000
Menotti-Raymond, M et al 2003: A1 Cat
chromosome A1
299.100 299.100 299.100
Menotti-Raymond, Marilyn et al 1999 (A): A1a Cat
chromosome A1
162.000 162.000 162.000


© The Roslin Institute 2007-2012, all rights reserved