This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012429


Marker Name:  XBM0024 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TTACCACTGAGCCACCTGG
Primer: ATGATGCTTCTGTCAAGAGGTT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (F): X Sheep
chromosome X
122.100 122.100 122.100
SM3 (A): X Sheep
chromosome X
32.200 32.200 32.200
SM3 Best Positions (A): X Sheep
chromosome X
33.700 33.700 33.700
SM3 Best Positions (F): X Sheep
chromosome X
6.500 6.500 6.500
SM3 Framework (F): X Sheep
chromosome X
5.600 5.600 5.600
SM4 Best Positions (A): X Sheep
chromosome X
33.700 33.700 33.700
SM4 Framework (A): X Sheep
chromosome X
32.200 32.200 32.200
SM4 Framework (F): X Sheep
chromosome X
5.600 5.600 5.600
SM4.2 Best Positions (A): X Sheep
chromosome X
33.700 33.700 33.700
SM4.2 Best Positions (F): X Sheep
chromosome X
6.500 6.500 6.500
SM4.2 Framework (A): X Sheep
chromosome X
32.200 32.200 32.200
SM4.2 Framework (F): X Sheep
chromosome X
5.600 5.600 5.600
SMC (F): X Sheep
chromosome X
6.500 6.500 6.500


© The Roslin Institute 2007-2012, all rights reserved