This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012406


Marker Name:  URB0068 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: ACAGCTACAGACCCAGGCAAGT
Primer: TAAGCCAGAGAAGTGAAAGGGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U21792

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 2 Sheep
chromosome 2
116.200 116.200 116.200
SM3 Best Positions (A): 2 Sheep
chromosome 2
115.800 115.800 115.800
SM3 Best Positions (F): 2 Sheep
chromosome 2
115.600 115.600 115.600
SM3 Best Positions (M): 2 Sheep
chromosome 2
116.300 116.300 116.300
SM3 Framework (F): 2 Sheep
chromosome 2
116.900 116.900 116.900
SM3 Framework (M): 2 Sheep
chromosome 2
116.600 116.600 116.600
SM4 Best Positions (A): 2 Sheep
chromosome 2
117.900 117.900 117.900
SM4 Framework (A): 2 Sheep
chromosome 2
118.600 118.600 118.600
SM4 Framework (F): 2 Sheep
chromosome 2
122.900 122.900 122.900
SM4 Framework (M): 2 Sheep
chromosome 2
116.300 116.300 116.300
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
117.900 117.900 117.900
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
120.700 120.700 120.700
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
115.900 115.900 115.900
SM4.2 Framework (A): 2 Sheep
chromosome 2
118.600 118.600 118.600
SM4.2 Framework (F): 2 Sheep
chromosome 2
123.000 123.000 123.000
SM4.2 Framework (M): 2 Sheep
chromosome 2
116.300 116.300 116.300


© The Roslin Institute 2007-2012, all rights reserved