This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012394


Marker Name:  URB0010 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: CTGGAGCATAACACGATCAGGAC
Primer: CCACTCCTTCTTTCAGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U21756

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (F): X Sheep
chromosome X
45.900 45.900 45.900
SM3 (A): X Sheep
chromosome X
68.600 68.600 68.600
SM3 Best Positions (A): X Sheep
chromosome X
71.400 71.400 71.400
SM3 Best Positions (F): X Sheep
chromosome X
89.100 89.100 89.100
SM3 Best Positions (M): X Sheep
chromosome X
58.600 58.600 58.600
SM3 Framework (F): X Sheep
chromosome X
90.200 90.200 90.200
SM4 Best Positions (A): X Sheep
chromosome X
72.800 72.800 72.800
SM4.2 Best Positions (A): X Sheep
chromosome X
72.800 72.800 72.800
SM4.2 Best Positions (F): X Sheep
chromosome X
91.900 91.900 91.900
SM4.2 Best Positions (M): X Sheep
chromosome X
58.600 58.600 58.600
SMC (F): X Sheep
chromosome X
86.000 86.000 86.000


© The Roslin Institute 2007-2012, all rights reserved