This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012322


Marker Name:  TGLA0441 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: CACAACTGGTAAAATGGCAGTGGCAG
Primer: GGCCAAGTCATCTGAATTTAATATACAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 10 Sheep
chromosome 10
12.500 12.500 12.500
SM2 (A): 10 Sheep
chromosome 10
63.800 63.800 63.800
SM3 (A): 10 Sheep
chromosome 10
84.100 84.100 84.100
SM3 Best Positions (A): 10 Sheep
chromosome 10
83.500 83.500 83.500
SM3 Best Positions (F): 10 Sheep
chromosome 10
87.000 87.000 87.000
SM3 Best Positions (M): 10 Sheep
chromosome 10
81.100 81.100 81.100
SM3 Framework (F): 10 Sheep
chromosome 10
87.400 87.400 87.400
SM3 Framework (M): 10 Sheep
chromosome 10
81.600 81.600 81.600
SM4 Best Positions (A): 10 Sheep
chromosome 10
83.700 83.700 83.700
SM4 Framework (A): 10 Sheep
chromosome 10
83.600 83.600 83.600
SM4 Framework (F): 10 Sheep
chromosome 10
87.300 87.300 87.300
SM4 Framework (M): 10 Sheep
chromosome 10
81.500 81.500 81.500
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
88.200 88.200 88.200
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
92.400 92.400 92.400
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
86.000 86.000 86.000
SM4.2 Framework (A): 10 Sheep
chromosome 10
83.600 83.600 83.600
SM4.2 Framework (F): 10 Sheep
chromosome 10
87.300 87.300 87.300
SM4.2 Framework (M): 10 Sheep
chromosome 10
81.500 81.500 81.500
SMC (A): 10 Sheep
chromosome 10
63.800 63.800 63.800


© The Roslin Institute 2007-2012, all rights reserved