This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012320


Marker Name:  TGLA0429 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: TGTACAGTCTGTGGTATAACTTCTT
Primer: TCTCCTAGAACCTGTCCTCCTAC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 22 Sheep
chromosome 22
55.900 55.900 55.900
SM3 (A): 22 Sheep
chromosome 22
64.500 64.500 64.500
SM3 Best Positions (A): 22 Sheep
chromosome 22
62.500 62.500 62.500
SM3 Best Positions (F): 22 Sheep
chromosome 22
51.000 51.000 51.000
SM3 Best Positions (M): 22 Sheep
chromosome 22
66.300 66.300 66.300
SM3 Framework (F): 22 Sheep
chromosome 22
54.100 54.100 54.100
SM3 Framework (M): 22 Sheep
chromosome 22
69.300 69.300 69.300
SM4 Best Positions (A): 22 Sheep
chromosome 22
61.800 61.800 61.800
SM4 Framework (A): 22 Sheep
chromosome 22
63.800 63.800 63.800
SM4 Framework (F): 22 Sheep
chromosome 22
52.700 52.700 52.700
SM4 Framework (M): 22 Sheep
chromosome 22
69.300 69.300 69.300
SM4.2 Best Positions (A): 22 Sheep
chromosome 22
62.100 62.100 62.100
SM4.2 Best Positions (F): 22 Sheep
chromosome 22
49.700 49.700 49.700
SM4.2 Best Positions (M): 22 Sheep
chromosome 22
66.300 66.300 66.300
SM4.2 Framework (A): 22 Sheep
chromosome 22
62.500 62.500 62.500
SM4.2 Framework (F): 22 Sheep
chromosome 22
49.800 49.800 49.800
SM4.2 Framework (M): 22 Sheep
chromosome 22
66.400 66.400 66.400
SMC (A): 22 Sheep
chromosome 22
55.900 55.900 55.900


© The Roslin Institute 2007-2012, all rights reserved