This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012310


Marker Name:  TGLA0325 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GGGCACTTTACTCTCTGAACAAATC
Primer: GCTGACAGTCTATTTCCAGAAGGTA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): X Sheep
chromosome X
30.100 30.100 30.100
SM3 (A): Y Sheep
chromosome Y
28.800 28.800 28.800
SM3 Best Positions (A): X Sheep
chromosome X
32.100 32.100 32.100
SM3 Best Positions (A): Y Sheep
chromosome Y
0.900 0.900 0.900
SM3 Best Positions (F): X Sheep
chromosome X
4.500 4.500 4.500
SM3 Best Positions (M): X Sheep
chromosome X
55.300 55.300 55.300
SM3 Framework (F): X Sheep
chromosome X
3.500 3.500 3.500
SM3 Framework (F): Y Sheep
chromosome Y
3.900 3.900 3.900
SM3 Framework (M): X Sheep
chromosome X
54.300 54.300 54.300
SM3 Framework (M): Y Sheep
chromosome Y
54.200 54.200 54.200
SM4 Best Positions (A): X Sheep
chromosome X
32.100 32.100 32.100
SM4 Framework (A): X Sheep
chromosome X
30.100 30.100 30.100
SM4 Framework (F): X Sheep
chromosome X
3.500 3.500 3.500
SM4 Framework (M): X Sheep
chromosome X
54.300 54.300 54.300
SM4.2 Best Positions (A): X Sheep
chromosome X
32.100 32.100 32.100
SM4.2 Best Positions (F): X Sheep
chromosome X
4.500 4.500 4.500
SM4.2 Best Positions (M): X Sheep
chromosome X
55.300 55.300 55.300
SM4.2 Framework (A): X Sheep
chromosome X
30.100 30.100 30.100
SM4.2 Framework (F): X Sheep
chromosome X
3.500 3.500 3.500
SM4.2 Framework (M): X Sheep
chromosome X
54.300 54.300 54.300


© The Roslin Institute 2007-2012, all rights reserved