This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012276


Marker Name:  TGLA0053 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: CAGCAGACAGCTGCAAGAGTTAGC
Primer: CTTTCAGAAATAGTTTGCATTCATGCAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 12 Sheep
chromosome 12
33.300 33.300 33.300
SM2 (A): 12 Sheep
chromosome 12
39.200 39.200 39.200
SM3 (A): 12 Sheep
chromosome 12
31.200 31.200 31.200
SM3 Best Positions (A): 12 Sheep
chromosome 12
34.400 34.400 34.400
SM3 Best Positions (F): 12 Sheep
chromosome 12
30.900 30.900 30.900
SM3 Best Positions (M): 12 Sheep
chromosome 12
37.500 37.500 37.500
SM3 Framework (F): 12 Sheep
chromosome 12
26.500 26.500 26.500
SM3 Framework (M): 12 Sheep
chromosome 12
34.800 34.800 34.800
SM4 Best Positions (A): 12 Sheep
chromosome 12
39.300 39.300 39.300
SM4 Framework (A): 12 Sheep
chromosome 12
39.300 39.300 39.300
SM4 Framework (F): 12 Sheep
chromosome 12
28.900 28.900 28.900
SM4 Framework (M): 12 Sheep
chromosome 12
48.100 48.100 48.100
SM4.2 Best Positions (A): 12 Sheep
chromosome 12
39.300 39.300 39.300
SM4.2 Best Positions (F): 12 Sheep
chromosome 12
31.300 31.300 31.300
SM4.2 Best Positions (M): 12 Sheep
chromosome 12
47.500 47.500 47.500
SM4.2 Framework (A): 12 Sheep
chromosome 12
39.300 39.300 39.300
SM4.2 Framework (F): 12 Sheep
chromosome 12
28.900 28.900 28.900
SM4.2 Framework (M): 12 Sheep
chromosome 12
48.100 48.100 48.100
SMC (A): 12 Sheep
chromosome 12
39.200 39.200 39.200


© The Roslin Institute 2007-2012, all rights reserved