This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012274


Marker Name:  TGLA0049 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: AGAAAAGGAATAATGAGACAGATTA
Primer: GGCAGGACTTCACTCTTTTTCA
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 1 Sheep
chromosome 1
33.500 33.500 33.500
SM2 (A): 1 Sheep
chromosome 1
112.700 112.700 112.700
SM3 Best Positions (A): 1 Sheep
chromosome 1
154.600 154.600 154.600
SM3 Best Positions (F): 1 Sheep
chromosome 1
143.700 143.700 143.700
SM3 Best Positions (M): 1 Sheep
chromosome 1
167.100 167.100 167.100
SM4 Best Positions (A): 1 Sheep
chromosome 1
154.200 154.200 154.200
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
150.700 150.700 150.700
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
135.600 135.600 135.600
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
166.900 166.900 166.900
SMC (A): 1 Sheep
chromosome 1
112.700 112.700 112.700


© The Roslin Institute 2007-2012, all rights reserved