This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012268


Marker Name:  TGLA0015 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GGTGACTGTACAACACTGTGAATG
Primer: TAGGCTATGGTCCAAGGGTTCAC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): X Sheep
chromosome X
36.700 36.700 36.700
SM3 Best Positions (A): X Sheep
chromosome X
39.600 39.600 39.600
SM3 Best Positions (F): X Sheep
chromosome X
19.300 19.300 19.300
SM3 Framework (F): X Sheep
chromosome X
15.400 15.400 15.400
SM4 Best Positions (A): X Sheep
chromosome X
39.600 39.600 39.600
SM4 Framework (A): X Sheep
chromosome X
36.400 36.400 36.400
SM4 Framework (F): X Sheep
chromosome X
14.700 14.700 14.700
SM4.2 Best Positions (A): X Sheep
chromosome X
39.600 39.600 39.600
SM4.2 Best Positions (F): X Sheep
chromosome X
19.200 19.200 19.200
SM4.2 Framework (A): X Sheep
chromosome X
36.900 36.900 36.900
SM4.2 Framework (F): X Sheep
chromosome X
15.700 15.700 15.700
SMC (F): X Sheep
chromosome X
21.700 21.700 21.700


© The Roslin Institute 2007-2012, all rights reserved