This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012242


Marker Name:  TCF7L2 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TTATCTTGGCTTCTGGGTGC
Primer: ATCTTCACTTGGGATGCAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G18511

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 22 Sheep
chromosome 22
9.500 9.500 9.500
SM2 (A): 22 Sheep
chromosome 22
38.700 38.700 38.700
SM3 (A): 22 Sheep
chromosome 22
45.000 45.000 45.000
SM3 Best Positions (A): 22 Sheep
chromosome 22
43.200 43.200 43.200
SM3 Best Positions (F): 22 Sheep
chromosome 22
33.300 33.300 33.300
SM3 Best Positions (M): 22 Sheep
chromosome 22
48.500 48.500 48.500
SM3 Framework (F): 22 Sheep
chromosome 22
36.400 36.400 36.400
SM3 Framework (M): 22 Sheep
chromosome 22
51.400 51.400 51.400
SM4 Best Positions (A): 22 Sheep
chromosome 22
43.200 43.200 43.200
SM4 Framework (A): 22 Sheep
chromosome 22
45.000 45.000 45.000
SM4 Framework (F): 22 Sheep
chromosome 22
36.500 36.500 36.500
SM4 Framework (M): 22 Sheep
chromosome 22
51.400 51.400 51.400
SM4.2 Best Positions (A): 22 Sheep
chromosome 22
43.500 43.500 43.500
SM4.2 Best Positions (F): 22 Sheep
chromosome 22
33.500 33.500 33.500
SM4.2 Best Positions (M): 22 Sheep
chromosome 22
48.500 48.500 48.500
SM4.2 Framework (A): 22 Sheep
chromosome 22
43.600 43.600 43.600
SM4.2 Framework (F): 22 Sheep
chromosome 22
33.500 33.500 33.500
SM4.2 Framework (M): 22 Sheep
chromosome 22
48.600 48.600 48.600
SMC (A): 22 Sheep
chromosome 22
38.700 38.700 38.700


© The Roslin Institute 2007-2012, all rights reserved