This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012217


Marker Name:  SOX2 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GACTTCTCCCAGTAGGCTGG
Primer: GCTGTTCGGAAGTGATGTAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G41010

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 1 Sheep
chromosome 1
238.300 238.300 238.300
SM3 Best Positions (A): 1 Sheep
chromosome 1
244.300 244.300 244.300
SM3 Framework (F): 1 Sheep
chromosome 1
220.900 220.900 220.900
SM3 Framework (M): 1 Sheep
chromosome 1
254.700 254.700 254.700
SM4 Best Positions (A): 1 Sheep
chromosome 1
243.800 243.800 243.800
SM4 Framework (A): 1 Sheep
chromosome 1
237.400 237.400 237.400
SM4 Framework (F): 1 Sheep
chromosome 1
219.700 219.700 219.700
SM4 Framework (M): 1 Sheep
chromosome 1
253.900 253.900 253.900
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
240.600 240.600 240.600
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
219.800 219.800 219.800
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
261.300 261.300 261.300
SM4.2 Framework (A): 1 Sheep
chromosome 1
237.400 237.400 237.400
SM4.2 Framework (F): 1 Sheep
chromosome 1
220.600 220.600 220.600
SM4.2 Framework (M): 1 Sheep
chromosome 1
253.100 253.100 253.100


© The Roslin Institute 2007-2012, all rights reserved