This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012175


Marker Name:  RM0356 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: GCATCACTAACATCCACTGAGG
Primer: CCACTAGGAGAGGTCATTCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: G29110

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 2 Sheep
chromosome 2
171.200 171.200 171.200
SM3 (A): 2 Sheep
chromosome 2
207.400 207.400 207.400
SM3 Best Positions (A): 2 Sheep
chromosome 2
206.100 206.100 206.100
SM3 Best Positions (F): 2 Sheep
chromosome 2
195.300 195.300 195.300
SM3 Best Positions (M): 2 Sheep
chromosome 2
215.600 215.600 215.600
SM3 Framework (F): 2 Sheep
chromosome 2
197.500 197.500 197.500
SM3 Framework (M): 2 Sheep
chromosome 2
217.200 217.200 217.200
SM4 Best Positions (A): 2 Sheep
chromosome 2
208.300 208.300 208.300
SM4 Framework (A): 2 Sheep
chromosome 2
210.000 210.000 210.000
SM4 Framework (F): 2 Sheep
chromosome 2
203.500 203.500 203.500
SM4 Framework (M): 2 Sheep
chromosome 2
216.900 216.900 216.900
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
209.200 209.200 209.200
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
200.700 200.700 200.700
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
217.400 217.400 217.400
SM4.2 Framework (A): 2 Sheep
chromosome 2
210.700 210.700 210.700
SM4.2 Framework (F): 2 Sheep
chromosome 2
203.200 203.200 203.200
SM4.2 Framework (M): 2 Sheep
chromosome 2
218.900 218.900 218.900
SMC (A): 2 Sheep
chromosome 2
171.200 171.200 171.200


© The Roslin Institute 2007-2012, all rights reserved