This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012135


Marker Name:  RJH1 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: TGATTTAGATGCTTTGCTAATGCCA
Primer: GGATTCTTTACCACTAGCCCCACCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U47049

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 9 Sheep
chromosome 9
126.300 126.300 126.300
SM3 Best Positions (A): 9 Sheep
chromosome 9
126.900 126.900 126.900
SM3 Best Positions (F): 9 Sheep
chromosome 9
119.300 119.300 119.300
SM3 Best Positions (M): 9 Sheep
chromosome 9
133.900 133.900 133.900
SM3 Framework (F): 9 Sheep
chromosome 9
115.300 115.300 115.300
SM3 Framework (M): 9 Sheep
chromosome 9
135.800 135.800 135.800
SM4 Best Positions (A): 9 Sheep
chromosome 9
126.900 126.900 126.900
SM4 Framework (A): 9 Sheep
chromosome 9
126.300 126.300 126.300
SM4 Framework (F): 9 Sheep
chromosome 9
115.300 115.300 115.300
SM4 Framework (M): 9 Sheep
chromosome 9
135.700 135.700 135.700
SM4.2 Best Positions (A): 9 Sheep
chromosome 9
126.900 126.900 126.900
SM4.2 Best Positions (F): 9 Sheep
chromosome 9
118.500 118.500 118.500
SM4.2 Best Positions (M): 9 Sheep
chromosome 9
134.700 134.700 134.700
SM4.2 Framework (A): 9 Sheep
chromosome 9
126.200 126.200 126.200
SM4.2 Framework (F): 9 Sheep
chromosome 9
114.400 114.400 114.400
SM4.2 Framework (M): 9 Sheep
chromosome 9
136.600 136.600 136.600
SM4.6 Best Positions (A): 9 Sheep
chromosome 9
126.900 126.900 126.900
SM4.6 Best Positions (F): 9 Sheep
chromosome 9
117.700 117.700 117.700
SM4.6 Best Positions (M): 9 Sheep
chromosome 9
135.500 135.500 135.500
SM4.7 Best Positions (A): 9 Sheep
chromosome 9
126.900 126.900 126.900
Wu, C.H. et al 2007: 9 Sheep
chromosome 9
876.620 876.620 876.620


© The Roslin Institute 2007-2012, all rights reserved