This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012134


Marker Name:  RHO 
Species:  Sheep
Marker Type:  RFLP
Publication ID: 7498748

PCR Primers

Primer: GTTAACTACAGTCTGTCCAGCTC
Primer: CTCCTCACACGGCTGCTGGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 19 Sheep
chromosome 19
41.800 41.800 41.800
SM2 (A): 19 Sheep
chromosome 19
81.000 81.000 81.000
SM3 Best Positions (A): 19 Sheep
chromosome 19
71.500 71.500 71.500
SM3 Best Positions (F): 19 Sheep
chromosome 19
66.300 66.300 66.300
SM3 Best Positions (M): 19 Sheep
chromosome 19
76.700 76.700 76.700
SM4 Best Positions (A): 19 Sheep
chromosome 19
71.900 71.900 71.900
SM4.2 Best Positions (A): 19 Sheep
chromosome 19
72.200 72.200 72.200
SM4.2 Best Positions (F): 19 Sheep
chromosome 19
67.800 67.800 67.800
SM4.2 Best Positions (M): 19 Sheep
chromosome 19
75.700 75.700 75.700
SM4.6 Best Positions (A): 19 Sheep
chromosome 19
71.100 71.100 71.100
SM4.6 Best Positions (F): 19 Sheep
chromosome 19
65.400 65.400 65.400
SM4.6 Best Positions (M): 19 Sheep
chromosome 19
75.500 75.500 75.500
SM4.7 Best Positions (A): 19 Sheep
chromosome 19
70.900 70.900 70.900
SMC (A): 19 Sheep
chromosome 19
81.000 81.000 81.000


© The Roslin Institute 2007-2012, all rights reserved