This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012130


Marker Name:  REN 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: CACGCTTCACACTTTCACCCCT
Primer: CTCCTCATGACCTCAAGTTTAAGCAGAT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4 Framework (A): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4 Framework (F): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4 Framework (M): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4.2 Best Positions (A): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4.2 Best Positions (F): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4.2 Best Positions (M): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4.2 Framework (A): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4.2 Framework (F): 12 Sheep
chromosome 12
0.000 0.000 0.000
SM4.2 Framework (M): 12 Sheep
chromosome 12
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved