This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012127


Marker Name:  RBP3 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: CTATGATCACCTTCTATGCTTCC
Primer: CCCTAAATACTACCATCTTAGAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M20748

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Beraldi, Dario et al 2006 (A): 25 Sheep
chromosome 25
200.000 200.000 200.000
SM1 (A): 25 Sheep
chromosome 25
38.000 38.000 38.000
SM2 (A): 25 Sheep
chromosome 25
49.200 49.200 49.200
SM3 (A): 25 Sheep
chromosome 25
69.200 69.200 69.200
SM3 Best Positions (A): 25 Sheep
chromosome 25
69.900 69.900 69.900
SM3 Best Positions (F): 25 Sheep
chromosome 25
56.200 56.200 56.200
SM3 Best Positions (M): 25 Sheep
chromosome 25
78.800 78.800 78.800
SM3 Framework (F): 25 Sheep
chromosome 25
58.700 58.700 58.700
SM3 Framework (M): 25 Sheep
chromosome 25
76.400 76.400 76.400
SM4 Best Positions (A): 25 Sheep
chromosome 25
69.900 69.900 69.900
SM4 Framework (A): 25 Sheep
chromosome 25
69.200 69.200 69.200
SM4 Framework (F): 25 Sheep
chromosome 25
58.700 58.700 58.700
SM4 Framework (M): 25 Sheep
chromosome 25
76.400 76.400 76.400
SM4.2 Best Positions (A): 25 Sheep
chromosome 25
69.900 69.900 69.900
SM4.2 Best Positions (F): 25 Sheep
chromosome 25
56.200 56.200 56.200
SM4.2 Best Positions (M): 25 Sheep
chromosome 25
78.800 78.800 78.800
SM4.2 Framework (A): 25 Sheep
chromosome 25
69.200 69.200 69.200
SM4.2 Framework (F): 25 Sheep
chromosome 25
58.700 58.700 58.700
SM4.2 Framework (M): 25 Sheep
chromosome 25
76.400 76.400 76.400
SM4.6 Best Positions (A): 25 Sheep
chromosome 25
68.300 68.300 68.300
SM4.6 Best Positions (F): 25 Sheep
chromosome 25
56.200 56.200 56.200
SM4.6 Best Positions (M): 25 Sheep
chromosome 25
76.600 76.600 76.600
SM4.7 Best Positions (A): 25 Sheep
chromosome 25
68.300 68.300 68.300
SMC (A): 25 Sheep
chromosome 25
49.200 49.200 49.200


© The Roslin Institute 2007-2012, all rights reserved