This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012079


Marker Name:  P38IP 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: GCGGCTCGCTCATTTTTAACACT
Primer: GTTGAGGACTAGAAGTTGTGGGTTGCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BE751401

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4 Best Positions (A): 10 Sheep
chromosome 10
22.300 22.300 22.300
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
27.300 27.300 27.300
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
25.500 25.500 25.500
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
28.000 28.000 28.000
SM4.6 Best Positions (A): 10 Sheep
chromosome 10
21.300 21.300 21.300
SM4.6 Best Positions (F): 10 Sheep
chromosome 10
17.100 17.100 17.100
SM4.6 Best Positions (M): 10 Sheep
chromosome 10
22.600 22.600 22.600
SM4.7 Best Positions (A): 10 Sheep
chromosome 10
21.300 21.300 21.300


© The Roslin Institute 2007-2012, all rights reserved