This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012068


Marker Name:  OLADRB1 
Species:  Sheep
Marker Type:  RFLP
Publication ID: 7498748

PCR Primers

Primer: TGTGCAGCGGCGAGGTGAG
Primer: CTGGCCGCCCACCCCCGCGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 20 Sheep
chromosome 20
35.000 35.000 35.000
SM2 (A): 20 Sheep
chromosome 20
28.700 28.700 28.700
SM3 (A): 20 Sheep
chromosome 20
41.400 41.400 41.400
SM3 Best Positions (A): 20 Sheep
chromosome 20
48.300 48.300 48.300
SM3 Best Positions (F): 20 Sheep
chromosome 20
43.900 43.900 43.900
SM3 Best Positions (M): 20 Sheep
chromosome 20
60.700 60.700 60.700
SM3 Framework (F): 20 Sheep
chromosome 20
34.800 34.800 34.800
SM3 Framework (M): 20 Sheep
chromosome 20
54.200 54.200 54.200
SM4 Best Positions (A): 20 Sheep
chromosome 20
48.300 48.300 48.300
SM4 Framework (A): 20 Sheep
chromosome 20
45.300 45.300 45.300
SM4 Framework (F): 20 Sheep
chromosome 20
38.700 38.700 38.700
SM4 Framework (M): 20 Sheep
chromosome 20
58.000 58.000 58.000
SM4.2 Best Positions (A): 20 Sheep
chromosome 20
51.200 51.200 51.200
SM4.2 Best Positions (F): 20 Sheep
chromosome 20
48.200 48.200 48.200
SM4.2 Best Positions (M): 20 Sheep
chromosome 20
60.600 60.600 60.600
SM4.2 Framework (A): 20 Sheep
chromosome 20
45.300 45.300 45.300
SM4.2 Framework (F): 20 Sheep
chromosome 20
38.700 38.700 38.700
SM4.2 Framework (M): 20 Sheep
chromosome 20
58.000 58.000 58.000
SMC (A): 20 Sheep
chromosome 20
28.700 28.700 28.700


© The Roslin Institute 2007-2012, all rights reserved