This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012050


Marker Name:  OARVH0117 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CACAAAGAGTCAGACATGCCCGAG
Primer: ATTGGCAGACATCCTTTCACTCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L12552

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 10 Sheep
chromosome 10
63.800 63.800 63.800
SM3 Best Positions (A): 10 Sheep
chromosome 10
63.800 63.800 63.800
SM3 Best Positions (F): 10 Sheep
chromosome 10
68.600 68.600 68.600
SM3 Best Positions (M): 10 Sheep
chromosome 10
60.100 60.100 60.100
SM3 Framework (F): 10 Sheep
chromosome 10
69.000 69.000 69.000
SM3 Framework (M): 10 Sheep
chromosome 10
60.100 60.100 60.100
SM4 Best Positions (A): 10 Sheep
chromosome 10
63.800 63.800 63.800
SM4 Framework (A): 10 Sheep
chromosome 10
63.400 63.400 63.400
SM4 Framework (F): 10 Sheep
chromosome 10
68.900 68.900 68.900
SM4 Framework (M): 10 Sheep
chromosome 10
60.000 60.000 60.000
SM4.2 Best Positions (A): 10 Sheep
chromosome 10
68.300 68.300 68.300
SM4.2 Best Positions (F): 10 Sheep
chromosome 10
74.000 74.000 74.000
SM4.2 Best Positions (M): 10 Sheep
chromosome 10
64.400 64.400 64.400
SM4.2 Framework (A): 10 Sheep
chromosome 10
63.400 63.400 63.400
SM4.2 Framework (F): 10 Sheep
chromosome 10
68.900 68.900 68.900
SM4.2 Framework (M): 10 Sheep
chromosome 10
60.000 60.000 60.000
SMC (A): 25 Sheep
chromosome 25
13.000 13.000 13.000


© The Roslin Institute 2007-2012, all rights reserved