This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012027


Marker Name:  OARJMP0036 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CCCACTTTCTGGAAGGCAGAAATG
Primer: CTTATTGTGTTTTCTGCCAGGGAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U35062

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 6 Sheep
chromosome 6
57.900 57.900 57.900
SM3 Best Positions (A): 6 Sheep
chromosome 6
63.400 63.400 63.400
SM3 Best Positions (F): 6 Sheep
chromosome 6
50.500 50.500 50.500
SM3 Best Positions (M): 6 Sheep
chromosome 6
75.900 75.900 75.900
SM3 Framework (F): 6 Sheep
chromosome 6
45.300 45.300 45.300
SM3 Framework (M): 6 Sheep
chromosome 6
69.000 69.000 69.000
SM4 Best Positions (A): 6 Sheep
chromosome 6
62.100 62.100 62.100
SM4 Framework (A): 6 Sheep
chromosome 6
56.900 56.900 56.900
SM4 Framework (F): 6 Sheep
chromosome 6
45.000 45.000 45.000
SM4 Framework (M): 6 Sheep
chromosome 6
66.400 66.400 66.400
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
62.100 62.100 62.100
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
50.300 50.300 50.300
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
73.300 73.300 73.300
SM4.2 Framework (A): 6 Sheep
chromosome 6
56.900 56.900 56.900
SM4.2 Framework (F): 6 Sheep
chromosome 6
45.000 45.000 45.000
SM4.2 Framework (M): 6 Sheep
chromosome 6
66.400 66.400 66.400
SMC (A): 6 Sheep
chromosome 6
61.500 61.500 61.500


© The Roslin Institute 2007-2012, all rights reserved