This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012024


Marker Name:  OARJMP0012 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CAAAGAATTGGCCACAACTGAGTGAC
Primer: GCCTGCTTTCTTTGCGTACAACTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U35060

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 Best Positions (A): 6 Sheep
chromosome 6
153.300 153.300 153.300
SM3 Best Positions (F): 6 Sheep
chromosome 6
132.800 132.800 132.800
SM3 Best Positions (M): 6 Sheep
chromosome 6
173.200 173.200 173.200
SM4 Best Positions (A): 6 Sheep
chromosome 6
151.900 151.900 151.900
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
152.200 152.200 152.200
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
132.100 132.100 132.100
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
171.000 171.000 171.000
SMC (A): 6 Sheep
chromosome 6
140.400 140.400 140.400


© The Roslin Institute 2007-2012, all rights reserved