This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012022


Marker Name:  OARJMP0008 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: CGGGATGATCTTCTGTCCAAATATGC
Primer: CATTTGCTTTGGCTTCAGAACCAGAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U35059

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 6 Sheep
chromosome 6
112.600 112.600 112.600
SM2 (A): 6 Sheep
chromosome 6
128.900 128.900 128.900
SM3 (A): 6 Sheep
chromosome 6
134.100 134.100 134.100
SM3 Best Positions (A): 6 Sheep
chromosome 6
137.000 137.000 137.000
SM3 Best Positions (F): 6 Sheep
chromosome 6
117.900 117.900 117.900
SM3 Best Positions (M): 6 Sheep
chromosome 6
154.500 154.500 154.500
SM3 Framework (F): 6 Sheep
chromosome 6
115.000 115.000 115.000
SM3 Framework (M): 6 Sheep
chromosome 6
150.900 150.900 150.900
SM4 Best Positions (A): 6 Sheep
chromosome 6
135.600 135.600 135.600
SM4 Framework (A): 6 Sheep
chromosome 6
129.000 129.000 129.000
SM4 Framework (F): 6 Sheep
chromosome 6
109.400 109.400 109.400
SM4 Framework (M): 6 Sheep
chromosome 6
145.700 145.700 145.700
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
135.500 135.500 135.500
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
116.100 116.100 116.100
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
153.400 153.400 153.400
SMC (A): 6 Sheep
chromosome 6
125.100 125.100 125.100


© The Roslin Institute 2007-2012, all rights reserved