This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012020


Marker Name:  OARJMP0004 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: GTAACGAGGCATGGTGCCTACAAC
Primer: CCAACATCTTGCTATGTGCATGTATG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U35056

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 6 Sheep
chromosome 6
110.200 110.200 110.200
SM3 Best Positions (A): 6 Sheep
chromosome 6
113.800 113.800 113.800
SM3 Best Positions (F): 6 Sheep
chromosome 6
96.000 96.000 96.000
SM3 Best Positions (M): 6 Sheep
chromosome 6
130.500 130.500 130.500
SM3 Framework (F): 6 Sheep
chromosome 6
92.600 92.600 92.600
SM3 Framework (M): 6 Sheep
chromosome 6
126.500 126.500 126.500
SM4 Best Positions (A): 6 Sheep
chromosome 6
112.300 112.300 112.300
SM4 Framework (A): 6 Sheep
chromosome 6
106.000 106.000 106.000
SM4 Framework (F): 6 Sheep
chromosome 6
88.000 88.000 88.000
SM4 Framework (M): 6 Sheep
chromosome 6
122.100 122.100 122.100
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
112.300 112.300 112.300
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
95.600 95.600 95.600
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
127.700 127.700 127.700
SM4.2 Framework (A): 6 Sheep
chromosome 6
109.100 109.100 109.100
SM4.2 Framework (F): 6 Sheep
chromosome 6
92.300 92.300 92.300
SM4.2 Framework (M): 6 Sheep
chromosome 6
124.000 124.000 124.000
SMC (A): 6 Sheep
chromosome 6
111.600 111.600 111.600


© The Roslin Institute 2007-2012, all rights reserved