This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012019


Marker Name:  OARJMP0001 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 11435411

PCR Primers

Primer: CAAAAGGACAAAGCTTGTCTGAGGCAC
Primer: CAAAGAGTCAGACATGACTGAACGAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U29949

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM3 (A): 6 Sheep
chromosome 6
73.900 73.900 73.900
SM3 Best Positions (A): 6 Sheep
chromosome 6
77.400 77.400 77.400
SM3 Best Positions (F): 6 Sheep
chromosome 6
65.000 65.000 65.000
SM3 Best Positions (M): 6 Sheep
chromosome 6
89.100 89.100 89.100
SM3 Framework (F): 6 Sheep
chromosome 6
61.300 61.300 61.300
SM3 Framework (M): 6 Sheep
chromosome 6
86.000 86.000 86.000
SM4 Best Positions (A): 6 Sheep
chromosome 6
76.100 76.100 76.100
SM4 Framework (A): 6 Sheep
chromosome 6
72.800 72.800 72.800
SM4 Framework (F): 6 Sheep
chromosome 6
61.000 61.000 61.000
SM4 Framework (M): 6 Sheep
chromosome 6
83.500 83.500 83.500
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
76.100 76.100 76.100
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
64.800 64.800 64.800
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
86.400 86.400 86.400
SM4.2 Framework (A): 6 Sheep
chromosome 6
72.800 72.800 72.800
SM4.2 Framework (F): 6 Sheep
chromosome 6
61.000 61.000 61.000
SM4.2 Framework (M): 6 Sheep
chromosome 6
83.500 83.500 83.500
SMC (A): 6 Sheep
chromosome 6
78.700 78.700 78.700


© The Roslin Institute 2007-2012, all rights reserved