This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012010


Marker Name:  OARHH0055 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: GTTATTCCATATTCTTTCCTCCATCATAAGC
Primer: CCACACAGAGCAACTAAAACCCAGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 6 Sheep
chromosome 6
28.900 28.900 28.900
SM2 (A): 6 Sheep
chromosome 6
47.900 47.900 47.900
SM3 (A): 6 Sheep
chromosome 6
51.200 51.200 51.200
SM3 Best Positions (A): 6 Sheep
chromosome 6
55.700 55.700 55.700
SM3 Best Positions (F): 6 Sheep
chromosome 6
43.900 43.900 43.900
SM3 Best Positions (M): 6 Sheep
chromosome 6
67.200 67.200 67.200
SM3 Framework (F): 6 Sheep
chromosome 6
39.400 39.400 39.400
SM3 Framework (M): 6 Sheep
chromosome 6
63.000 63.000 63.000
SM4 Best Positions (A): 6 Sheep
chromosome 6
54.600 54.600 54.600
SM4 Framework (A): 6 Sheep
chromosome 6
50.200 50.200 50.200
SM4 Framework (F): 6 Sheep
chromosome 6
39.100 39.100 39.100
SM4 Framework (M): 6 Sheep
chromosome 6
60.500 60.500 60.500
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
54.600 54.600 54.600
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
43.700 43.700 43.700
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
64.900 64.900 64.900
SM4.2 Framework (A): 6 Sheep
chromosome 6
50.200 50.200 50.200
SM4.2 Framework (F): 6 Sheep
chromosome 6
39.100 39.100 39.100
SM4.2 Framework (M): 6 Sheep
chromosome 6
60.500 60.500 60.500
SMC (A): 6 Sheep
chromosome 6
54.300 54.300 54.300


© The Roslin Institute 2007-2012, all rights reserved