This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011988


Marker Name:  OARFCB0011 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: GGCCTGAACTCACAAGTTGATATATCTATCAC
Primer: GCAAGCAGGTTCTTTACCACTAGCACC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L01531

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 2 Sheep
chromosome 2
280.900 280.900 280.900
SM3 (A): 2 Sheep
chromosome 2
308.100 308.100 308.100
SM3 Best Positions (A): 2 Sheep
chromosome 2
306.300 306.300 306.300
SM3 Best Positions (F): 2 Sheep
chromosome 2
287.400 287.400 287.400
SM3 Best Positions (M): 2 Sheep
chromosome 2
325.900 325.900 325.900
SM3 Framework (F): 2 Sheep
chromosome 2
288.400 288.400 288.400
SM3 Framework (M): 2 Sheep
chromosome 2
328.800 328.800 328.800
SM4 Best Positions (A): 2 Sheep
chromosome 2
307.600 307.600 307.600
SM4 Framework (A): 2 Sheep
chromosome 2
307.400 307.400 307.400
SM4 Framework (F): 2 Sheep
chromosome 2
288.900 288.900 288.900
SM4 Framework (M): 2 Sheep
chromosome 2
326.500 326.500 326.500
SM4.2 Best Positions (A): 2 Sheep
chromosome 2
308.400 308.400 308.400
SM4.2 Best Positions (F): 2 Sheep
chromosome 2
289.500 289.500 289.500
SM4.2 Best Positions (M): 2 Sheep
chromosome 2
328.500 328.500 328.500
SM4.2 Framework (A): 2 Sheep
chromosome 2
308.100 308.100 308.100
SM4.2 Framework (F): 2 Sheep
chromosome 2
288.600 288.600 288.600
SM4.2 Framework (M): 2 Sheep
chromosome 2
328.500 328.500 328.500
SMC (A): 2 Sheep
chromosome 2
280.900 280.900 280.900


© The Roslin Institute 2007-2012, all rights reserved