This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011974


Marker Name:  OARCP0093 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 9501303

PCR Primers

Primer: AAAATTTCGCTCCCTCCCTCTCTTTCC
Primer: AGTCGGATATATGTATGTGTGTATGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U08881

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM2 (A): 1 Sheep
chromosome 1
28.600 28.600 28.600
SM3 (A): 1 Sheep
chromosome 1
72.600 72.600 72.600
SM3 Best Positions (A): 1 Sheep
chromosome 1
77.200 77.200 77.200
SM3 Best Positions (F): 1 Sheep
chromosome 1
72.700 72.700 72.700
SM3 Best Positions (M): 1 Sheep
chromosome 1
83.800 83.800 83.800
SM3 Framework (F): 1 Sheep
chromosome 1
65.600 65.600 65.600
SM3 Framework (M): 1 Sheep
chromosome 1
81.200 81.200 81.200
SM4 Best Positions (A): 1 Sheep
chromosome 1
77.100 77.100 77.100
SM4 Framework (A): 1 Sheep
chromosome 1
72.600 72.600 72.600
SM4 Framework (F): 1 Sheep
chromosome 1
65.600 65.600 65.600
SM4 Framework (M): 1 Sheep
chromosome 1
81.200 81.200 81.200
SM4.2 Best Positions (A): 1 Sheep
chromosome 1
73.600 73.600 73.600
SM4.2 Best Positions (F): 1 Sheep
chromosome 1
64.800 64.800 64.800
SM4.2 Best Positions (M): 1 Sheep
chromosome 1
83.800 83.800 83.800
SM4.2 Framework (A): 1 Sheep
chromosome 1
72.300 72.300 72.300
SM4.2 Framework (F): 1 Sheep
chromosome 1
65.100 65.100 65.100
SM4.2 Framework (M): 1 Sheep
chromosome 1
81.100 81.100 81.100
SMC (A): 1 Sheep
chromosome 1
28.600 28.600 28.600


© The Roslin Institute 2007-2012, all rights reserved