This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011956


Marker Name:  OARAE0101 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TAAGAAATATATTTGAAAAAACTGTATCTCCC
Primer: TTCTTATAGATGCACTCAAGCTAGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 6 Sheep
chromosome 6
24.200 24.200 24.200
SM2 (A): 6 Sheep
chromosome 6
42.300 42.300 42.300
SM3 (A): 6 Sheep
chromosome 6
46.800 46.800 46.800
SM3 Best Positions (A): 6 Sheep
chromosome 6
50.900 50.900 50.900
SM3 Best Positions (F): 6 Sheep
chromosome 6
41.600 41.600 41.600
SM3 Best Positions (M): 6 Sheep
chromosome 6
59.000 59.000 59.000
SM3 Framework (F): 6 Sheep
chromosome 6
37.900 37.900 37.900
SM3 Framework (M): 6 Sheep
chromosome 6
54.700 54.700 54.700
SM4 Best Positions (A): 6 Sheep
chromosome 6
49.700 49.700 49.700
SM4 Framework (A): 6 Sheep
chromosome 6
45.800 45.800 45.800
SM4 Framework (F): 6 Sheep
chromosome 6
37.700 37.700 37.700
SM4 Framework (M): 6 Sheep
chromosome 6
52.200 52.200 52.200
SM4.2 Best Positions (A): 6 Sheep
chromosome 6
49.800 49.800 49.800
SM4.2 Best Positions (F): 6 Sheep
chromosome 6
41.300 41.300 41.300
SM4.2 Best Positions (M): 6 Sheep
chromosome 6
56.600 56.600 56.600
SM4.2 Framework (A): 6 Sheep
chromosome 6
45.800 45.800 45.800
SM4.2 Framework (F): 6 Sheep
chromosome 6
37.700 37.700 37.700
SM4.2 Framework (M): 6 Sheep
chromosome 6
52.200 52.200 52.200
SMC (A): 6 Sheep
chromosome 6
49.800 49.800 49.800


© The Roslin Institute 2007-2012, all rights reserved