This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011953


Marker Name:  OARAE0054 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: 7498748

PCR Primers

Primer: TACTAAAGAAACATGAAGCTCCCAC
Primer: GGAAACATTTATTCTTATTCCTCAGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L11048

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM1 (A): 25 Sheep
chromosome 25
31.800 31.800 31.800
SM2 (A): 25 Sheep
chromosome 25
40.800 40.800 40.800
SM3 (A): 25 Sheep
chromosome 25
63.200 63.200 63.200
SM3 Best Positions (A): 25 Sheep
chromosome 25
64.000 64.000 64.000
SM3 Best Positions (F): 25 Sheep
chromosome 25
53.400 53.400 53.400
SM3 Best Positions (M): 25 Sheep
chromosome 25
70.600 70.600 70.600
SM3 Framework (F): 25 Sheep
chromosome 25
55.900 55.900 55.900
SM3 Framework (M): 25 Sheep
chromosome 25
68.200 68.200 68.200
SM4 Best Positions (A): 25 Sheep
chromosome 25
64.000 64.000 64.000
SM4 Framework (A): 25 Sheep
chromosome 25
63.200 63.200 63.200
SM4 Framework (F): 25 Sheep
chromosome 25
55.900 55.900 55.900
SM4 Framework (M): 25 Sheep
chromosome 25
68.200 68.200 68.200
SM4.2 Best Positions (A): 25 Sheep
chromosome 25
64.000 64.000 64.000
SM4.2 Best Positions (F): 25 Sheep
chromosome 25
53.400 53.400 53.400
SM4.2 Best Positions (M): 25 Sheep
chromosome 25
70.600 70.600 70.600
SM4.2 Framework (A): 25 Sheep
chromosome 25
63.200 63.200 63.200
SM4.2 Framework (F): 25 Sheep
chromosome 25
55.900 55.900 55.900
SM4.2 Framework (M): 25 Sheep
chromosome 25
68.200 68.200 68.200
SMC (A): 25 Sheep
chromosome 25
40.800 40.800 40.800


© The Roslin Institute 2007-2012, all rights reserved