This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00011907


Marker Name:  MNS0089 
Species:  Sheep
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: GTAACCCTACACAAGGAACACC
Primer: AAGCCTTCTCTAGAGGCTCTTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF259761

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
SM4.2 Best Positions (A): 9 Sheep
chromosome 9
109.100 109.100 109.100
SM4.2 Best Positions (F): 9 Sheep
chromosome 9
104.000 104.000 104.000
SM4.2 Best Positions (M): 9 Sheep
chromosome 9
113.700 113.700 113.700
SM4.2 Framework (A): 9 Sheep
chromosome 9
108.300 108.300 108.300
SM4.2 Framework (F): 9 Sheep
chromosome 9
100.400 100.400 100.400
SM4.2 Framework (M): 9 Sheep
chromosome 9
115.500 115.500 115.500


© The Roslin Institute 2007-2012, all rights reserved